The nonpurple allele of anthocyaninless that you worked with is
an insertion mutation that causes the gene to make a nonfunctional
product. However, there are many possible mutations that can
inactivate a gene’s function. Below is some sequence from the first
exon of the anthocyaninless gene with the start codon bold and
italicized.

Mark one base substitution that you predict would also cause a
nonpurple allele. Explain why you think it would cause a nonopurple
allele.

Mark one base substitution that you predict would NOT affect the
gene’ function. Explain why you think it would not change the
gene’s function.

ACAAAGATGGTAGCTCACAAAGAGACCGTGTGCGTAACCGGCGCATCAGGATTCATTGGTTCATGGCTC